multiscripe® reverse transcriptase (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
multiscripe® reverse transcriptase
Multiscripe® Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiscripe+reverse+transcriptase/multiscripe++reverse+transcriptase/pmc08563617__125_2021_5557_MOESM1_ESM-36-25-37
Average 90 stars, based on 1 article reviews
Multiscripe® Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiscripe+reverse+transcriptase/multiscripe++reverse+transcriptase/pmc08563617__125_2021_5557_MOESM1_ESM-36-25-37
Average 90 stars, based on 1 article reviews
multiscripe® reverse transcriptase - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: Exercise-induced liver chemokine CXCL-1 expression is linked to muscle-derived interleukin-6 expression Article Snippet: Reverse transcription was performed using MultiScripe Reverse Transcriptase ( Reverse Transcription:Article Title: Methods for controlling gene expression using ta-siRNA Article Snippet: The primers and probes used were: PDS forward primer MW-P83F (TTGGAGAACTTGGGATCAATG) (SEQ ID NO: 211), PDS reverse primer MW-P84R (GGCATAGCAAAAATCATGGAG) (SEQ ID NO: 212), PDS Taqman probe #86 (GCAGTGGA) (SEQ ID NO: 214) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689119001); GAPDH forward primer MW-P71F (TCGAGGGAACAGGAGTGTTT) (SEQ ID NO: 197), GAPDH reverse primer MW-P72R(CTCCGGCTTGGATATGCTT) (SEQ ID NO: 198), GAPDH taqman probe #68 (AGGAGCAG) (SEQ ID NO: 207) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04688678001); Actin 2 forward primer MW-P67F (TCCTTGTACGCCAGTGGTC) (SEQ ID NO: 199), Actin 2 reverse primer MW-P68R(CACGTCCAGCAAGGTCAAG) (SEQ ID NO: 200), Actin 2 Taqman probe #88 (CATCCTCC) (SEQ ID NO: 208) from Roche Applied Science Q-RT-PCR universal probe library (cat# 04689135001) Total RNA was purified from plants using Trizol Reagent (Invitrogen, #15596-026). .. Fifteen ng of the total RNA was used in reverse transcription reaction (15 L) using reverse primers and Article Title: Calcium influx determines the muscular response to electrotransfer. Article Snippet: Hojman P, Brolin C, Gissel H. Calcium influx determines the muscular response to electrotransfer.. Am J Physiol Regul Integr Comp Physiol 302: R446–R453, 2012.. First published December 7, 2011; doi:10.1152/ajpregu.00383.2011.—Cell membrane permeabilization by electric pulses (electropermeabilization), results in free exchange of ions across the cell membrane. Reverse Transcription Polymerase Chain Reaction:Article Title: Calcium influx determines the muscular response to electrotransfer. Article Snippet: Hojman P, Brolin C, Gissel H. Calcium influx determines the muscular response to electrotransfer.. Am J Physiol Regul Integr Comp Physiol 302: R446–R453, 2012.. First published December 7, 2011; doi:10.1152/ajpregu.00383.2011.—Cell membrane permeabilization by electric pulses (electropermeabilization), results in free exchange of ions across the cell membrane. |